The Best Cyprus Community

Skip to content


Still no confirmed Corona cases in Cyprus, but for how long?

Feel free to talk about anything that you want.

Re: Still no confirmed Corona cases in Cyprus, but for how l

Postby Kikapu » Tue Jul 14, 2020 3:37 pm

cyprusgrump wrote:
Kikapu wrote:
cyprusgrump wrote:
Kikapu wrote:Sweden did not achieve herd immunity despite not having a lockdown. The most they got was 6% of the population, and even then, the antibodies were not long lasting in the body. Many Swedes died to Coronavirus for nothing by not having a lockdown, in the gamble to achieve herd immunity.


You continually present your (flawed) opinion as fact... :roll:

I suggest you get less of your 'news' from the Bedwetting Broadcasting Corporation.... :lol:

How is that 50% to 100% increase in daily deaths you forecast coming along BTW...? :wink:

Kikapu Fri Jul 03, 2020 7:18 pm wrote:Actually, as of recent times, 5,000 are dropping dead a day world wide. I expect those figures to rise by 50%-100% in the next 2-4 weeks.


Now is the relative calm before the storm. :wink:

Be patient, CG. The USA alone will lead the new high death numbers soon.

Do you think all those 3rd world countries are reporting all their deaths due to coronavirus?

Do you even think those 3rd world countries even know people are dying from coronavirus?

Do you really think today we only have 5,000 deaths a day relating to coronavirus? :roll:


Just to be clear Kiks, are you now extending your prediction of 50% to 100% more daily deaths within 2-4 weeks from Friday July 3rd...? :roll:

Kikapu Fri Jul 03, 2020 7:18 pm wrote:Actually, as of recent times, 5,000 are dropping dead a day world wide. I expect those figures to rise by 50%-100% in the next 2-4 weeks.


I note with interest (as I think Tim noted) that the 'Gold Standard' of 'total daily deaths as reported by the ONS' has been dropped by Bedwetters for some obfuscation along the lines of...

Kikapu wrote:Do you really think today we only have 5,000 deaths a day relating to coronavirus? :roll:


Too funny! :lol: :lol: :lol:


No CG, no changes to my July 3rd predictions. :D
User avatar
Kikapu
Leading Contributor
Leading Contributor
 
Posts: 18107
Joined: Sun Apr 16, 2006 6:18 pm

Re: Still no confirmed Corona cases in Cyprus, but for how l

Postby Kikapu » Tue Jul 14, 2020 3:40 pm

cyprusgrump wrote:I'm wondering if Bedwetters Kiks, MR, GR and ErLolz sit in front of their PCs with masks on in case Tim or I sneeze into our keyboards? :lol:

:lol: :lol: :lol:
No but, I’m sure your doctor did when you had a visit with him/her with the Misses recently, no? :wink:
User avatar
Kikapu
Leading Contributor
Leading Contributor
 
Posts: 18107
Joined: Sun Apr 16, 2006 6:18 pm

Re: Still no confirmed Corona cases in Cyprus, but for how l

Postby repulsewarrior » Tue Jul 14, 2020 4:55 pm

User avatar
repulsewarrior
Leading Contributor
Leading Contributor
 
Posts: 14445
Joined: Sat Apr 08, 2006 2:13 am
Location: homeless in Canada

Re: Still no confirmed Corona cases in Cyprus, but for how l

Postby Tim Drayton » Tue Jul 14, 2020 5:32 pm

More evidence that the coronavirus was doing the rounds in Europe earlier than thought. A swab taken from a patient being treated for suspected pneumonia in France in December has tested positive for Covid.

https://www.bbc.com/news/world-europe-52526554
User avatar
Tim Drayton
Main Contributor
Main Contributor
 
Posts: 8799
Joined: Sat Jul 21, 2007 1:32 am
Location: Limassol/Lemesos

Re: Still no confirmed Corona cases in Cyprus, but for how l

Postby cyprusgrump » Tue Jul 14, 2020 6:45 pm

Kikapu wrote:
No CG, no changes to my July 3rd predictions. :D



I am impressed that you are prepared to stand by it - even tho it is clear you will be out by miles, or thousands or whatever!

Kudos to you Kiks... :wink:

Because you know I won't forget and on July 31st (4 weeks) I'll post the daily deaths from the same site that you quoted on July 3rd and you'll be proven wrong, no...? :?

But I'm sure there will be 'reasons'... :wink:
User avatar
cyprusgrump
Main Contributor
Main Contributor
 
Posts: 8571
Joined: Thu Sep 01, 2005 4:35 pm
Location: Pissouri, Cyprus

Re: Still no confirmed Corona cases in Cyprus, but for how l

Postby Kikapu » Wed Jul 15, 2020 9:16 am

cyprusgrump wrote:
Kikapu wrote:
No CG, no changes to my July 3rd predictions. :D


Because you know I won't forget and on July 31st (4 weeks) I'll post the daily deaths from the same site that you quoted on July 3rd and you'll be proven wrong, no...? :?
:

And which site would that be, CG? :? :? :wink:
User avatar
Kikapu
Leading Contributor
Leading Contributor
 
Posts: 18107
Joined: Sun Apr 16, 2006 6:18 pm

Re: Still no confirmed Corona cases in Cyprus, but for how l

Postby Tim Drayton » Wed Jul 15, 2020 9:31 am

I came across the following article that picks serious holes in the officially promoted narrative about so-called Covid-19:

http://www.preearth.net/phpBB3/viewtopi ... =15&t=1184

The author does not provide any information as to his/her credentials or background but appears to be well versed in genetics and a lot of the analysis comes from examining the genomes of various strains of the virus. Some of the argument is quite technical and even goes over my head, so I may have misunderstood. If so, I stand ready to be corrected.

As I understand it, these are some of the most important points:

• The virus has undergone 8,047 distinct mutations worldwide since supposedly originating in Wuhan, China in December 2019. It is impossible for a virus to undergo so many mutations in such a space of time. Therefore, various strains of the virus must have already been in existence in other places before December 2019. The author argues that a separate strain of the virus had been present in Europe for some time.

• The virus is said to have first been spread to Europe by a Chinese businesswoman who travelled from Shanghai to Munich on Jan 19, 2020 to attend meetings with her German colleagues. However, the mutations present in the viruses means that it is impossible for the virus to have spread in the way the officially promoted narrative suggests for such reasons as: “Relative to the standard Wuhan sequence, the virus from Patient 1 has lost (from its beginning) the segment ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGT. However, the virus from Patient 3 has lost (from its beginning) only the shorter segment ATTAAAGGTTTATACCTTCCCAGGTAACA.”

• The author presents data comparing the transport facilities and passenger numbers between Wuhan and the rest of China to those between China and Iran, and argues convincingly that it is inconceivable that the virus spread from Wuhan to Iran without spreading to the rest of China, given the tiny number of people who travelled from China to Iran compared to the vast numbers of travellers from Wuhan to the rest of China.

Sadly, I have to conclude that even news sources like the BBC, which I once trusted, have been spinning a false narrative. It makes me sad as a Briton because the BBC, with its reputation for reliable reporting of the news, helped to enhance the UK’s reputation and soft power in the world. However, it is futile to engage in denial. The BBC is now heavily financed by the Bill and Melinda Gates Foundation and it clearly has to promote the narrative the latter is pushing in common with other media outlets financed by big pharma or front organizations for its interests.
User avatar
Tim Drayton
Main Contributor
Main Contributor
 
Posts: 8799
Joined: Sat Jul 21, 2007 1:32 am
Location: Limassol/Lemesos

Re: Still no confirmed Corona cases in Cyprus, but for how l

Postby Tim Drayton » Wed Jul 15, 2020 11:03 am

More than 600 of the nation’s physicians sent a letter to President Trump this week calling the coronavirus shutdowns a “mass casualty incident” with “exponentially growing negative health consequences” to millions of non COVID patients.

“The downstream health effects…are being massively under-estimated and under-reported. This is an order of magnitude error,” according to the letter initiated by Simone Gold, M.D., an emergency medicine specialist in Los Angeles.

https://www.forbes.com/sites/gracemarie ... 22d9ee50fa
User avatar
Tim Drayton
Main Contributor
Main Contributor
 
Posts: 8799
Joined: Sat Jul 21, 2007 1:32 am
Location: Limassol/Lemesos

Re: Still no confirmed Corona cases in Cyprus, but for how l

Postby Tim Drayton » Wed Jul 15, 2020 11:23 am

Bible Experts Determine Goliath Died Of COVID-19

https://babylonbee.com/news/bible-exper ... f-covid-19
User avatar
Tim Drayton
Main Contributor
Main Contributor
 
Posts: 8799
Joined: Sat Jul 21, 2007 1:32 am
Location: Limassol/Lemesos

Re: Still no confirmed Corona cases in Cyprus, but for how l

Postby Kikapu » Wed Jul 15, 2020 12:15 pm

Tim Drayton wrote:Bible Experts Determine Goliath Died Of COVID-19

https://babylonbee.com/news/bible-exper ... f-covid-19


Oh, I thought he died from David-19! :lol:
User avatar
Kikapu
Leading Contributor
Leading Contributor
 
Posts: 18107
Joined: Sun Apr 16, 2006 6:18 pm

PreviousNext

Return to General Chat

Who is online

Users browsing this forum: Shinergybpv and 8 guests